L1: Design of oligonucleotides

To design oligonucleotides for your PCR you need a map of the DNA and protein sequences. You also need a codon usage table to select a codon used by Escherichia coli.

For the mutation with the PCR method you will need two oligos which both contain the mutation and which are complementary to each other. A third shorter oligo will be used in a PCR hybridization analysis.

This example shows you how you can approach the oligo design problem. Suppose we want to mutate of H89 to N. We can then choose to do this through a single base exchange CAT to AAT. Other possibilities should also be considered. One should where possible select high frequency codons.

wt
81 I  P  L  S  V  L  D  D  H  P  R  I  D  L  A  I  D  G  A  D        
  ATTCCGCTCTCCGTTCTCGATGATCATCCTCGAATTGACCTCGCCATTGATGGCGCCGAT

mutant
81 I  P  L  S  V  L  D  D  N  P  R  I  D  L  A  I  D  G  A  D       
  ATTCCGCTCTCCGTTCTCGATGATAATCCTCGAATTGACCTCGCCATTGATGGCGCCGAT

1. We need two complementary oligonucleotides with the mutation in the center. The oligos should be about 18 nt on each side of the mutation (max. length of oligo = 46 nt) and the GC content about 40-50% (optimally 50%). If possible, the first and last nucleotide of the oligos should be a G or a C. Our first mutation oligo FS.H89N1 thus has the following sequence:

   5' CTCTCCGTTCTCGATGATAATCCTCGAATTGACCTCG 3'

2. The second oligo nucleotide is an exact complement to FS.H89N1. To write the complementary oligo in 5' to 3' direction it is convenient to make use of the link http://arbl.cvmbs.colostate.edu/molkit/ (on a PC, you might need to use http://www.basic.northwestern.edu/biotools/oligocalc.html instead). Click on “Manipulate Sequences”. Paste the oligo FS.H89N1 in the window and select “Inverse Complement”. This will give you the sequence of mutation oligo FS.H89N2.

   5' CGAGGTCAATTCGAGGATTATCATCGAGAACGGAGAG 3'

3. The melting temperature (T_m) of your mutation oligos are calculated using the following formula:

T_m = 81,5 + 0,41(%GC) - 675/N -%mismatch             (T_m should be ~78 °C)

where N is the length (in nucleotides) of your oligo.

Calculate the T_m for at least one of your mutagenesis oligos using the formula above. Use this excel file (or this link) to check that your numbers are correct and to calculate the T_m for the remaining mutagenesis oligos.

4. And finally our analytical hybridization oligo (ex FS.H89N3) is:

   5' CTCTCCGTTCTCGATGATA 3'

This oligo will be used in an analytical PCR together with an oligo (RpiA reverse or RpiA forward), which binds complementary to the 3 ' or 5' end, respectively, of the rpiA gene. With the help of these two oligos we will amplify the DNA, but only if the mutation was successful.

5. Calculate the melting temperature (Tm) of your analytical primer using the Primer design software available at http://www.cybergene.se/primerdesign/genewalker/genewalker11.html (alternatively, http://www.basic.northwestern.edu/biotools/oligocalc.html). Type in your oligo sequence in the “Primer 1 sequence” box, click on “2:ary structure”, and check out the result to the right. The melting temperature should be ~58°C. NB, make sure to click “Clear results” before you start analyzing the next oligo. You can use the same tool to check the secondary structure of your primer.

6. Send your oligos by e-mail to Sanjeewani (sanjee.soori@icm.uu.se) with the following information included:
               Mutation (e.g. D6A)
               Oligo id (what you want to call your oligo) ex. FS.D6A1, FS.D6A2, FS.D6A3 (analytical)
               T_m 

Back to top

RpiA protein sequence

rpiA gene sequence in FASTA format 

(if you are having trouble with the format of the FASTA sequence, get it from this link instead)

CCCATGGGATCTCATCATCATCATCATCATGGAGTCTTAACTCAAGACGATCTCAAGAAA
CTCGCCGCCGAAAAAGCCGTCGACTCCGTCAAATCCGGCATGGTTCTCGGTCTCGGAACC
GGAAGTACTGCCGCATTTGCTGTCTCGCGAATCGGCGAGCTTCTCTCTGCCGGAAAACTG
ACCAACATCGTTGGAATTCCTACCTCGAAGCGGACCGCAGAGCAGGCGGCGTCTCTTGGA
ATTCCGCTCTCCGTTCTCGATGATCATCCTCGAATTGACCTCGCCATTGATGGCGCCGAT
GAGGTTGATCCTGATCTTAATCTGGTTAAGGGGCGCGGTGGGGCGCTCTTGAGAGAAAAG
ATGGTTGAAGCTGCTAGTGATAAATTTATTGTTGTTGTTGATGATACTAAGCTTGTTGAT
GGTTTGGGTGGTAGTCGTCTTGCTATGCCTGTTGAAGTTGTTCAATTTTGCTGGAAATAT
AATCTCAAGAGATTACAGGAGATCTTTAAGGAGCTGGGTTGTGAGGCaAAATTGAGAATG
GAAGGGGATAGCAGTCCTTATGTGACTGACAACTCGAATTACATCGTGGATTTATACTTC
CCGACCTCGATTAAGGATGCTGAAGCTGCAGGGAGAGAAATTTCGGCCTTGGAAGGCGTA
GTAGAACATGGGTTGTTCTTGGGTATGGCTAGCGAAGTCATCATTGCTGGGAAAACTGGA
GTTAGTGTGAAAACCAAGTGA

Back to top

RpiA reverse oligo sequence: 5'-CCAGCAATGATGACTTCGCTA-3'

RpiA forward oligo sequence: 5'-CTCAAGAAACTCGCCGCCGAA-3'

Codon usage in E. coli
from Hénaut and Danchin: Analysis and Predictions from Escherichia coli sequences. Escherichia coli and Salmonella, Vol. 2, Ch. 114:2047-2066, 1996, Neidhardt FC ed., ASM press, Washington, D.C.

Genes are clustered by using factorial correspondence analysis into three classes. Class I contains genes involved in most metabolic processes. Class II genes correspond to genes highly and continuously expressed during exponential growth. Class III genes are implicated in horizontal transfer of DNA. One can see that the distribution of codons in class III genes is more or less even, whereas it is extremely biased in class II genes (in particular, codons terminated in A are selected against).